Ετικέτες

Τετάρτη 5 Απριλίου 2017

Quantitative study on nitrogen deposition and canopy retention in Mediterranean evergreen forests

Abstract

To assess the impact of nitrogen (N) pollutants on forest ecosystems, the role of the interactions in the canopy needs to be understood. A great number of studies have addressed this issue in heavily N-polluted regions in north and central Europe. Much less information is available for the Iberian Peninsula, and yet this region is home to mountain forests and alpine grasslands that may be at risk due to excessive N deposition. To establish the basis for ecology-based policies, there is a need to better understand the forest response to this atmospheric impact. To fill this gap, in this study, we measured N deposition (as bulk, wet, and throughfall fluxes of dissolved inorganic nitrogen) and air N gas concentrations from 2011 to 2013 at four Spanish holm oak (Quercus ilex) forests located in different pollution environments. One site was in an area of intensive agriculture, two sites were influenced by big cities (Madrid and Barcelona, respectively), and one site was in a rural mountain environment 40 km north of Barcelona. Wet deposition ranged between 0.54 and 3.8 kg N ha−1 year−1 for ammonium (NH4+)-N and between 0.65 and 2.1 kg N ha−1 year−1 for nitrate (NO3)-N, with the lowest deposition at the Madrid site for both components. Dry deposition was evaluated with three different approaches: (1) a canopy budget model based in throughfall measurements, (2) a branch washing method, and (3) inferential calculations. Taking the average dry deposition from these methods, dry deposition represented 51–67% (reduced N) and 72–75% (oxidized N) of total N deposition. Canopies retained both NH4+-N and NO3-N, with a higher retention at the agricultural and rural sites (50–60%) than at sites located close to big cities (20–35%, though more uncertainty was found for the site near Madrid), thereby highlighting the role of the forest canopy in processing N pollutant emissions.



http://ift.tt/2o5EPQt

Simulating changes in cropping practices in conventional and glyphosate-resistant maize. II. Weed impacts on crop production and biodiversity

Abstract

Overreliance on the same herbicide mode of action leads to the spread of resistant weeds, which cancels the advantages of herbicide-tolerant (HT) crops. Here, the objective was to quantify, with simulations, the impact of glyphosate-resistant (GR) weeds on crop production and weed-related wild biodiversity in HT maize-based cropping systems differing in terms of management practices. We (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, with the weed dynamics model FlorSys; (2) quantified how much the presence of GR weeds contributed to weed impacts on crop production and biodiversity; (3) determined the effect of cultural practices on the impact of GR weeds and (4) identified which species traits most influence weed-impact indicators. The simulation study showed that during the analysed 28 years, the advent of glyphosate resistance had little effect on plant biodiversity. Glyphosate-susceptible populations and species were replaced by GR ones. Including GR weeds only affected functional biodiversity (food offer for birds, bees and carabids) and weed harmfulness when weed effect was initially low; when weed effect was initially high, including GR weeds had little effect. The GR effect also depended on cultural practices, e.g. GR weeds were most detrimental for species equitability when maize was sown late. Species traits most harmful for crop production and most beneficial for biodiversity were identified, using RLQ analyses. None of the species presenting these traits belonged to a family for which glyphosate resistance was reported. An advice table was built; the effects of cultural practices on crop production and biodiversity were synthesized, explained, quantified and ranked, and the optimal choices for each management technique were identified.



http://ift.tt/2nGzJqu

Environmental photocatalysis and photochemistry for a sustainable world: a big challenge



http://ift.tt/2o5IRIu

A brief review and evaluation of earthworm biomarkers in soil pollution assessment

Abstract

Earthworm biomarker response to pollutants has been widely investigated in the assessment of soil pollution. However, whether and how the earthworm biomarker-approach can be actually applied to soil pollution assessment is still a controversial issue. This review is concerned about the following points:

  1. Despite much debate, biomarker is valuable to ecotoxicology and biomarker approach has been properly used in different fields. Earthworm biomarker might be used in different scenarios such as large-scale soil pollution survey and soil pollution risk assessment. Compared with physicochemical analysis, they can provide more comprehensive and straightforward information about soil pollution at low cost.

  2. Although many earthworm species from different ecological categories have been tested, Eisenia fetida/andrei is commonly used. Many earthworm biomarkers have been screened from the molecular to the individual level, while only a few biomarkers, such as avoidance behavior and lysosomal membrane stability, have been focused on. Other aspects of the experimental design were critically reviewed.

  3. More studies should focus on determining the reliability of various earthworm biomarkers in soil pollution assessment in future research. Besides, establishing a database of a basal level of each biomarker, exploring biomarker response in different region/section/part of earthworm, and other issues are also proposed.

  4. A set of research guideline for earthworm biomarker studies was recommended, and the suitability of several earthworm biomarkers was briefly evaluated with respect to their application in soil pollution assessment.

This review will help to promote further studies and practical application of earthworm biomarker in soil pollution assessment.



http://ift.tt/2nGwxLt

Emissions analysis on diesel engine fuelled with cashew nut shell biodiesel and pentanol blends

Abstract

The present work is intended to investigate the emission characteristics of neat cashew nut shell methyl ester (CNSME100) by adding pentanol at two different proportions and compared with the baseline diesel. CNSME100 is prepared by the conventional transesterification process. CNSME100 is chosen due to its non-edible nature. Pentanol is chosen as an additive because of its higher inbuilt oxygen content and surface to volume ratio which reduces the drawbacks of neat CNSME100. Emission characteristics were carried out in single cylinder naturally aspirated CI engine fuelled with neat cashew nut shell methyl ester (CNSME), cashew nut shell methyl ester and pentanol by 10% volume (CNSME90P10), cashew nut shell methyl ester and pentanol by 20% volume (CNSME80P20), and diesel. This work also aims to investigate the feasibility of operating an engine fuelled with neat methyl ester and alcohol blends. Experimental results showed that by blending higher alcohol to neat cashew nut shell methyl ester reduces the emissions significantly. It is also found that the emission from neat methyl ester and pentanol blends is lesser than diesel at all loads.



http://ift.tt/2o5KPZh

Does the use of distiller’s dried grains with solubles (DDGS) in layer diets affect the nutrients digestibility and manure pollution by nitrogen and phosphorous?

Abstract

The objective of the current study was to examine the effect of the inclusion levels of distiller's dried grains with solubles (DDGS) which partially and fully replaced soybean meal (SBM) in laying hen diets with or without enzyme or vitamin E supplementation on nutrients digestibility and excreted nitrogen and phosphorous. For these purposes, a total of 180 Hisex Brown laying hens at 22 weeks of age were randomly distributed into 15 treatment groups in a 5 × 3 factorial design experiment including five levels of DDGS (0, 5.5, 11, 16.5 and 22% replaced for the same percent of SBM which represents 0, 25, 50, 75 and 100% respectively in the diet) and three levels of feed additives (without, 250 mg enzyme/kg diet or 200 mg vitamin E/kg diet) through 22–42 weeks of age. Results revealed that digestion coefficient values of nutrients including DM, OM, CP, EE, NFE and CF were more preferable in hens fed diets involved 25% DDGS instead of SBM than that of the control diet and other treatment groups. In contrast, hens fed 100% substitution of DDGS caused significant (P ≤ 0.01) decrease in digestibility coefficients of all nutrients. The amount of daily excreted N was decreased in hens fed 25 or 50% DDGS substitution, whilst feeding 75 or 100% DDGS led to an elevation in N excretion. The proportion of excreted phosphorous was statistically (P ≤ 0.01) decreased as the level of DDGS increased. Generally, neither enzyme nor vitamin E supplementation had any significant effect on the studied parameters. It could be concluded that DDGS could be used up to 50% as a replacement of SBM (11% of the diet) without any adverse effects on nutrients digestibility. Laying hen farms using DDGS up to 25 or 50% substituted for SBM in its diets (5.5 or 11% of the diet) will have clearer environment of nitrogen and phosphorous pollution than others whose diets free of DDGS.



http://ift.tt/2nGjDNC

A soil biotechnology system for wastewater treatment: technical, hygiene, environmental LCA and economic aspects

Abstract

Soil biotechnology (SBT) is a green engineering approach for wastewater treatment and recycling. Five SBT units located in the Mumbai region were under consideration of which holistic assessment of two SBT plants was carried out considering its technical, environmental and economic aspects and was compared with published research of other three. LCA has been done to evaluate the environmental impacts of construction and operation phase of SBT. Chemical oxygen demand (COD) and biochemical oxygen demand (BOD) removal of more than 90% can be achieved using this technology. Also, the nutrient removal proficiency (nitrate, nitrite, ammoniacal nitrogen, TKN, total nitrogen and phosphates) of this technique is good. On the other hand, SBT has low annual operation and maintenance cost, comparable to land-based systems and lower than conventional or advanced technologies. From the life cycle impact assessment, the main contributors for overall impact from the plant were identified as electricity consumption, discharges of COD, P-PO43− and N-NH4+ and disposal of sludge. The construction phase was found to have significantly more impact than the operation phase of the plant. This study suggests plant I is not relatively as efficient enough regarding sanitation. SBT provides several benefits over other conventional technologies for wastewater treatment. It is based on a bio-conversion process and is practically maintenance free. It does not produce any odorous bio-sludge and consumes the least energy.



http://ift.tt/2nGwyz1

A refined method for analysis of 4,4′-dicofol and 4,4′-dichlorobenzophenone

Abstract

The acaricide, dicofol, is a well-known pesticide and partly a substitute for dichlorodiphenyltrichloroethane (DDT). Only few reports on environmental occurrence and concentrations have been reported calling for improvements. Hence, an analytical method was further developed for dicofol and dichlorobenzophenone (DCBP) to enable assessments of their environmental occurrence. Concentrated sulfuric acid was used to remove lipids and to separate dicofol from DCBP. On-column injection was used as an alternative to splitless injection to protect dicofol from thermal decomposition. By the method presented herein, it is possible to quantify dicofol and DCBP in the same samples. Arctic cod (Gadus morhua) were spiked at two dose levels and the recoveries were determined. The mean recovery for dicofol was 65% at the low dose (1 ng) and 77% at the high dose (10 ng). The mean recovery for DCBP was 99% at the low dose (9.2 ng) and 146% at the high dose (46 ng). The method may be further improved by use of another lipid removal method, e.g., gel permeation chromatography. The method implies a step forward in dicofol environmental assessments.



http://ift.tt/2o5rEz0

Electronic cigarettes: age-specific generation-resolved pulmonary doses

Abstract

Particle size-number distributions of aerosol from e-cigarettes (0 and 14 mg mL−1 nicotine) were compared with conventional cigarettes. Results were used to provide age-specific (9–21 years) dosimetry estimates applying the MMPD model. After a 2-s puff, total number doses (D Tot ) were highest for 9 years of age (6.01 × 1010–1.31 × 1011 particles) and lowest for 18 years of age (4.69 × 1010–1.06 × 1011 particles). Such doses represented about 19–45 and 25–100% of the relevant daily doses of not smoking individuals, respectively, in tracheobronchial (TB) and alveolar (A) regions. D Tot for the e-cigarettes were about double that for conventional cigarette. Deposition densities and daily volume of e-cigarette liquid deposited per unit surface area were maximum at lobar bronchi, highest for 9 years and lowest for 21 years age.



http://ift.tt/2nGw4sx

Removal of PFOA and PFOS from aqueous solutions using activated carbon produced from Vitis vinifera leaf litter

Abstract

The removal of perfluorooctanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) from aqueous solutions using agro-waste biomass of Vitis vinifera (grape) leaf litter was studied. Activated carbons were produced from the biomass and chemical activation achieved by using phosphoric acid (H3PO4) and potassium hydroxide (KOH) for the modification of the carbons' surface morphology. Activated carbons were characterized using Fourier transform infrared spectroscopy, scanning electron microscopy and Brunauer–Emmett–Teller (BET) in order to understand removal mechanisms of the contaminants by activated carbons. The effect of solution concentration, pH, adsorbent dosage, contact time and temperature was evaluated to optimize the removal efficiency of activated carbons. Adsorption isotherm models were used to analyse the equilibrium data obtained, and kinetic models were applied to study sorption mechanisms. The results fitted well into Freundlich isotherm with both AC-KOH and AC-H3PO4 having high K f values. Maximum adsorption capacities for AC-H3PO4 were 78.90 and 75.13 mg/g for PFOA and PFOS, respectively. Equilibrium was reached before 60 min on both adsorbents, and thermodynamic studies indicated that the process was exothermic and spontaneous. Surface morphology showed the abundance of microspores (>60%) with BET total surface area of 295.488 and 158.67 m2/g for AC-H3PO4 and AC-KOH activated carbons, respectively. Removal efficiencies were 95 and 90% for PFOA using AC-H3PO4 and AC-KOH, respectively; corresponding values for PFOS were 94 and 88%. Adsorbents' removal capacities depended on the physicochemical characteristics of adsorbents.



http://ift.tt/2o5IPAm

Association of Pre-residency Peer Reviewed Publications with Radiation Oncology Resident Choice of Academic Versus Private Practice Career

Publication date: Available online 5 April 2017
Source:Practical Radiation Oncology
Author(s): Shearwood McClelland, Charles R Thomas, Lynn D Wilson, Emma B Holliday, Jerry J Jaboin
IntroductionThe decision of radiation oncology residents to pursue academic versus private practice careers plays a central role in shaping the present and future of the field, yet factors potentially predictive of this decision are lacking. This study was performed to examine the role of several factors publicly available prior to residency on post-residency career choice, including pre-residency peer-reviewed publications (PRP) which have been associated with resident career choice in comparably competitive subspecialties such as neurosurgery.MethodsUsing a combination of internet searches, telephone interviews, and the 2015 Association of Residents in Radiation Oncology (ARRO) directory, a list of 2016 radiation oncology resident graduates was compiled along with their post-residency career choice. PRP was defined as the number of PubMed publications encompassing the end of the calendar year (2010) in which residency applications were due; this number was then correlated with career choice.Results163 residents from 76 Accreditation Council for Graduate Medical Education-certified programs were examined. 78% were male, 22% were MD/PhD, and 79 graduates (48%) chose academic careers. 52% of graduates had at least one PRP at the time of application to radiation oncology residency; 35% had more than one PRP. Regarding career choice, the difference between 0 and 1+ PRP was statistically significant (odds ratio=3.3; p<0.01), but not between 1 and >1 PRP. Gender, PhD or non-PhD dual degree status were not associated with career choice.ConclusionRadiation oncology residency graduates with one or more peer-reviewed publications at the time of residency application were roughly two times more likely to choose an academic career as their initial career choice than graduates with no pre-residency peer-reviewed publications. This information may prove useful to medical students, medical school advisors and residency program directors, and deserves further prospective investigation.



http://ift.tt/2nZUNtS

Association of established hypothyroidism-associated genetic variants with Hashimoto’s thyroiditis

Abstract

Purpose

Hashimoto's thyroiditis (HT) as a chronic autoimmune disease of the thyroid gland is the most common cause of hypothyroidism. Since HT and hypothyroidism are closely related, the main aim of this study was to explore the association of established hypothyroidism single-nucleotide polymorphisms (SNPs) with HT.

Methods

The case–control dataset included 200 HT cases and 304 controls. Diagnosis of HT cases was based on clinical examination, measurement of thyroid antibodies (TgAb, TPOAb), hormones (TSH and FT4) and ultrasound examination. We genotyped and analysed 11 known hypothyroidism-associated genetic variants. Case–control association analysis was performed in order to test each SNP for the association with HT using logistic regression model. Additionally, each SNP was tested for the association with thyroid-related quantitative traits (TPOAb levels, TgAb levels and thyroid volume) in HT cases only using linear regression.

Results

We identified two genetic variants nominally associated with HT rs3184504 in SH2B3 gene (P = 0.0135, OR = 0.74, 95% CI = 0.57–0.95) and rs4704397 in PDE8B gene (P = 0.0383, OR = 1.32, 95% CI = 1.01–1.74). The SH2B3 genetic variant also showed nominal association with TPOAb levels (P = 0.0163, β = −0.46) and rs4979402 inside DFNB31 gene was nominally associated with TgAb levels (P = 0.0443, β = 0.41).

Conclusions

SH2B3 gene has previously been associated with susceptibility to several autoimmune diseases, whereas PDE8B has been associated with TSH levels and suggested to modulate thyroid physiology that may influence the manifestation of thyroid disease. Identified loci are novel and biologically plausible candidates for HT development and represent good basis for further exploration of HT susceptibility.



http://ift.tt/2oamnX5

Scholar : Ειδοποίηση Μελετητή - [ CPAP ]

Ειδοποίηση Μελετητή:[ CPAP ]

[HTML] Continuous Positive Airway Pressure Improves Arterial Stiffness and Endothelial Progenitor Cells (CD34+ cells)

M Yang, A Cho, CC Domingues, N Ahmadi, N Kundu… - 2017
... Continuous positive airway pressure (CPAP) is the gold standard when it comes to treating
patients with OSA, and has shown to decrease cardiovascular risk in OSA patients. We studied
the effect of CPAP on the EPCs and arterial stiffness in OSA patients. ...
Google+ Facebook Twitter

A Dictionary of Anaesthesia

J Shorthouse - 2017
Google+ Facebook Twitter

[PDF] ACNR

C Ashton, M Needham, J Ostick, M Nowell, W Selbi…
Page 1. ACNR ISSN 1473-9348 VOLUME 16 ISSUE 4 FEBRUARY-APRIL 2017
www.acnr.co.uk BOOK REVIEWS > INDUSTRY NEWS > CONFERENCE PREVIEWS AND
REPORTS > EVENTS DIARY ADVANCES IN CLINICAL NEUROSCIENCE & REHABILITATION ...
Google+ Facebook Twitter

[DOC] USD 10,739,450 Parallel co-financing

AEZAE Zone, AF Agroforestry, C Celsius…
Ministry of Environment, Forest and Climate Change, Ethiopia. United Nations
Development Programme. Project title: Integrated Landscape Management to Enhance
Food Security and Ecosystem Resilience in Ethiopia. Country ...
Google+ Facebook Twitter


Αυτή η Ειδοποίηση του Μελετητή Google σας προσφέρεται από τη Google

Ακύρωση ειδοποίησης
Δημιουργία λίστας των ειδοποιήσεών μου


Scholar : Ειδοποίηση Μελετητή - [ Obstructiv

Ειδοποίηση Μελετητή:[ Obstructive sleep apnea ]

Cognitive and motor reaction times in Obstructive Sleep Apnea Syndrome. A study based on computerized measures

M Devita, S Montemurro, M Argentieri, G Dinoi… - Thirty-Fifth European …, 2017
Abstract (eng): Obstructive Sleep Apnea syndrome (OSAs) is often reported as mainly
associated with executive dysfunction. Although delayed reaction times in patients with
OSAs have also been reported (Kilpinen et al., 2014), sensitivity of processing speed has
Google+ Facebook Twitter

[HTML] Continuous Positive Airway Pressure Improves Arterial Stiffness and Endothelial Progenitor Cells (CD34+ cells)

M Yang, A Cho, CC Domingues, N Ahmadi, N Kundu… - 2017
... Document Type. Poster. Keywords. Obstructive Sleep Apnea (OSA); endothelial progenitor
cells (EPCs); Continuous positive airway pressure (CPAP); arterial stiffness (AS); Pulse
Wave Velocity (PWV). Publication Date. Spring 2017. Abstract. ...
Google+ Facebook Twitter

[PDF] Exploding Head Syndrome with Co-morbid Sleep Apnea

AS Ali, A Aftab, A Ajaz - Oman Medical Journal, 2017
... of 13; poor sleep) and Berlin Questionnaire (2 out of 3 positive categories; high risk for obstructive
sleep apreal (OSA)).5 An overnight sleep study was also carried out to investigate breathing
disorder using ApneaLinkTM ResMed (an economical Sleep Apnea screening tool).6 ...
Google+ Facebook Twitter

Benefits and Adverses Effects of Testosterone Therapy

EMF Costa, LGL Amato, LFG Silveira - Testosterone, 2017
... It is not recommended to begin testosterone replacement therapy in men with untreated severe
obstructive sleep apnea or with benign prostatic hypertrophy. ... Male pattern balding (familial).
Growth of breast cancer. Induction or worsening of obstructive sleep apnea. Conclusions. ...
Google+ Facebook Twitter

C1q-ADIPONECTIN COMPLEX AND USE THEREOF

I Shimomura, T Funahashi, K Kishida, H Kobayashi… - US Patent 20,170,082,620, 2017
... 1108-16; NPL 5: Nakagawa Y, Kishida K, Kihara S, et al., Nocturnal reduction in circulating
adiponectin concentrations related to hypoxic stress in severe obstructive sleep
apnea-hypopnea syndrome, Am J Physiol Endocrinol Metab, 2008; 294: pp. ...
Google+ Facebook Twitter

Sedation

A Annamalai - Medical Management of Psychotropic Side Effects, 2017
... Obstructive sleep apnea (OSA) is a frequently unrecognized cause of poor sleep and daytime
sedation. As OSA is associated with serious cardiovascular comorbidities, patients reporting
poor sleep should be screened. Asking about snoring and apneic breathing and ...
Google+ Facebook Twitter

[HTML] A Rare Case of Corynebacterium propinquum Endocarditis in a Native Valve

K Kuriakose, J Rutland, TE Watts, K Chatterjee… - Journal of Medical Cases, 2017
... A 63-year-old Caucasian male with a history of type 2 diabetes mellitus, obstructive sleep apnea,
and chronic obstructive pulmonary disease was admitted in early December with complaints
of 9 days of fevers up to 38.3 °C, chills and rigors, and headache of 3 - 4 days duration. ...
Google+ Facebook Twitter

Testosterone Therapy: Injectable Androgens

AA Yassin - Testosterone, 2017
... MeT Methyltestosterone. mg Milligram. ml Milliliter. MS Metabolic syndrome. OSA Obstructive
sleep apnea. PSA Prostate-specific antigen. QoL Quality of life. SARM Selective androgen receptor
modulator. SERM Selective estrogen receptor modulators. T Testosterone. TE ...
Google+ Facebook Twitter

[HTML] Effect of intranasal dexmedetomidine on emergence agitation after sevoflurane anesthesia in children undergoing tonsillectomy and/or adenoidectomy

AMA El-Hamid, HM Yassin - Saudi Journal of Anaesthesia, 2017
... Patients with obstructive sleep apnea, mental retardation or developmental delay, chest, cardiac
or neurological diseases, known allergy or hypersensitivity to dexmedetomidine, and patients
receiving medications known to interact with dexmedetomidine such as furosemide ...
Google+ Facebook Twitter

Hypertension and Acute Hypertensive Crisis

A Annamalai - Medical Management of Psychotropic Side Effects, 2017
... Primary hypertension is the most common reason for elevated BP. Major secondary causes are
medications, alcohol, nicotine, stimulant drugs, chronic renal disease, obstructive sleep apnea,
and less commonly endocrine disorders, hyperaldosteronism, pheochromocytoma. ...
Google+ Facebook Twitter


Αυτή η Ειδοποίηση του Μελετητή Google σας προσφέρεται από τη Google

Ακύρωση ειδοποίησης
Δημιουργία λίστας των ειδοποιήσεών μου


Scholar : Ειδοποίηση Μελετητή - [ ΣΤΟΜΑ

Ειδοποίηση Μελετητή:[ ΣΤΟΜΑΤΙΤΙΣ ]

[PDF] Effect of Nigella sativa Extracts on Candida Species Adhesion to Acrylic Denture Base Material and on Nanomechanical Properties of the Denture Material

AM Albarrag, OY Alothman, MA Elsharawy, MF Al Rez… - Advanced Materials, 2017
... India ABSTRACT Denture stomatitis is common among denture wearers. Candida ...
sp. to PMMA and yeast biofilm formation on PMMA. KEYWORDS: Dental Stomatitis,
Yeast, Biofilm, Poly(methyl methacrylate), Herbal Extract. 1 ...
Google+ Facebook Twitter

[HTML] A rare case of Kindler's syndrome associated with multiple eruptive melanocytic nevi

T Arif, M Adil, SS Amin, K Dorjay - Indian Journal of Paediatric Dermatology, 2017
... dyschromia, and telangiectasia [Figure 2]. Multiple well-defined pigmented macules were
appreciated distributed discretely over trunk and limbs, each measuring around 3–5 mm in
diameter [Figure 3]. Examination of the oral mucosa showed angular stomatitis, poor dental ...
Google+ Facebook Twitter

Caspases rule the intracellular trafficking cartel

C Duclos, C Lavoie, JB Denault - The FEBS Journal, 2017
... Golgi network; TNF, tumor necrosis factor; Tpr, tetratricopeptide repeat; VHS, VPS-27, Hrs, and
STAM; VSV-G, vesicular stomatitis virus G protein. Page 3. Accepted Article ... apoptosis [36]. By
employing thermo-reversible folding mutant of the vesicular stomatitis ...
Google+ Facebook Twitter

Combination Therapies for Treating Her2-Positive Cancers that are Resistant to Her2-Targeted Therapies

C Espelin, E Geretti, V Moyo, JG Reynolds, T Wickham… - US Patent 20,170,080,087, 2017
... Patients should be carefully monitored for toxicity. Adverse reactions, such as PPE, hematologic
toxicities, and stomatitis may be managed by dose delays and adjustments. ... 3.0, 25%. Dose
Adjustments for Palmar-Plantar Erythrodysesthesia Syndrom (Ppe) and Stomatitis: ...
Google+ Facebook Twitter

[HTML] A Case Report of Refractory Gout: Efficacy of High-Dose Anti-IL1r Treatment

LA Cardoso, JP Abreu, Y Anzola, S Foreid, I Almeida… - Journal of Medical Cases, 2017
... Patient showed good response with MTX and corticoid, during 2 months, and then had adverse
reaction to MTX, with severe herpetic stomatitis, thrombocytopenia, and mild hepatitis. MTX was
suspended, and high-dose corticotherapy was initiated - prednisolone 1 mg/kg/day. ...
Google+ Facebook Twitter

Analyzing trapped protein complexes by Virotrap and SFINX

K Titeca, E Van Quickelberghe, N Samyn, D De Sutter… - Nature Protocols, 2017
... eg, Kutner et al.) 17 . Single-step enrichment of VLPs was enabled by coexpression
of the vesicular stomatitis virus G (VSV-G) protein and a FLAG-tagged version of
this pseudotyping protein. Upon expression, these proteins ...
Google+ Facebook Twitter

[HTML] In sickness and in health: Clinical research and social media

S Ray - Perspectives in Clinical Research, 2017
... and ethical manner. Social media can boost study recruitment, [19] for example,
Novartis used a Twitter feed to boost awareness of a phase 2 trial involving stomatitis
and breast cancer, and others have used text messaging; ...
Google+ Facebook Twitter

Use of Translation Blocking Morpholinos for Gene Knockdown in Giardia lamblia

M Oligomers - 2017
... EYPYDVPDYAEYPYDVPDYAEYPYDVPDYAGS. gaatatccttatgacgtcccagactacgcggagtaccca
tacgatgtacctgattatgctgagtacccatacgacgtaccagattacgctggatcc. 3802. 3×VSVG (GOOD). Vesicular
stomatitis virus (VSV-G) tag. YTDIEMNRLGKGSYTDIEMNRLGKGSYTDIEMNRLGK. ...
Google+ Facebook Twitter

[PDF] Multidrug Resistance and Production of Extended Spectrum β-lactamases and Plasmid-mediated AmpC β-lactamases in Enterobacteriaceae isolates from diseased …

DFL Piccolo
... 30.7% rhinitis, 3.9% otitis, 2.9% conjunctivitis, 1% abscess, 2% stomatitis, 1% cystitis).
Bacterial susceptibility testing to n= 8 ... total isolates and recovered from the 20% (n=18) of
cats, affected by diarrhoea, rhinitis, abscess, otitis, stomatitis and cystitis. ...
Google+ Facebook Twitter

[PDF] ความ ส� า เร็ จ ของ การ รักษา ด้วย รากฟัน เทียม ยึด ครอบ ฟัน ติด แน่น ณ ศูนย์ ความ เป็น เลิศ ทาง ทันต กรรม ราก เทียม มหาวิทยาลัย เชียงใหม่

K Weerapong, M Chantaramungkorn, PA Reichart…
... especially autoimmune diseases and chronic oral diseases, such as erosive lichen planus,
Sjogren's syndrome, leukoplakia, stomatitis, aphthous ulcera- tion, lupus erythematosus, and
diabetes mellitus.(9-11) The other variables that are within the control of ...
Google+ Facebook Twitter


Αυτή η Ειδοποίηση του Μελετητή Google σας προσφέρεται από τη Google

Ακύρωση ειδοποίησης
Δημιουργία λίστας των ειδοποιήσεών μου


Αναζήτηση αυτού του ιστολογίου